General Comments

The baseline reference for this system is CRE recombinase-based positive-negative selection systems for genetic manipulation in Trypanosoma brucei (2008) Scahill MD, Pastar I & Cross GAM. Molecular and Biochemical Parasitology 157:73-82. DOI PMC PMID. It is suggested that you read at least parts of this paper, especially the discussion! We have only used this system in bloodstream forms, although the Donelson lab demonstrated its utility (and toxicity) in procyclics (Barrett B, LaCount DJ & Donelson JE (2004) Trypanosoma brucei: a first-generation CRE-loxP site-specific recombination system. Exp Parasitol 106:37-44. DOI). The reported toxicity can probably be avoided by transiently expressing cre, or using the crippled expression vectors described below.

The following comments were written after publication of the Scahill 2008 paper. We have since written another brief report Strategies to construct null and conditional null Trypanosoma brucei mutants using Cre-recombinase and loxP (2013) Kim, H-S, Li Z, Boothroyd, C & Cross, GAM, Molecular and Bochemical Parasitology in press, which describes additional constructs for gene deletion and conditional gene deletion, with or without epitope-tagging the gene to be deleted. The plasmids described in this later paper are listed below.

The 'floxed' (flanked by lox) constructs listed here are the enhanced versions referred to in the discussion of the above paper. The most important features are:

(1) the floxed constructs are available with 5 positive-selectable markers. The sequences of these have been checked but, at the time of writing, not all have been functionally tested for GCV sensitivity, nor have we tested the extent to which other than the HYG-TK and PUR-TK fusions are split after synthesis.
(2) the version of the HSVTK that is used contains the mutations that rendered mammalian cells 40-fold more sensitive to GCV (Creation of drug-specific Herpes simplex virus type 1 thymidine kinase mutants for gene therapy (1996) Black ME, Newcomb TG, Wilson HM & Loeb LA. Proc Natl Acad Sci U S A 93:3525-9. URL). Although this mutation had no effect on GCV sensitivity of T. brucei when expressed from the beta-TUBULIN locus in HMI-9 lacking thymidine, it could make a difference at other loci.
(3) these versions contain the most efficient splice site that we know of, downstream of the upstream lox site. This was done with the intention of ensuring high expression of the fusion protein at any targeted locus regardless of the SAS at that locus. Whether this in fact makes a difference has not been tested by us. On the other hand, we have not included a constant 3' UTR, so the one at your specific target locus could lead to variable expression (probably by modulating RNA stability).
(4) inactivation of pyrimidine synthesis, when these constructs are targeted as constructed, after linearization with PvuII, did not affect growth in culture. However, although the media generally ensure an abundant supply of pyrimidines we supplement HMI-9 with Uracil. In mice, I originally though that inactivation of pyrimidine synthesis was preventing establishment of an infection. A similar deficiency in pyrimidine synthesis was previously shown to prevent infection of mice by Toxoplasma (De novo pyrimidine biosynthesis is required for virulence of Toxoplasma gondii (2002) Fox BA & Bzik DJ. Nature 415:926-9. DOI PMID). However, more careful studies in the lab have shown that there is only small effect on infection kinetics in mice receiving normal commercial feed.

Using the floxed vectors

The floxed targeting vectors can be tested at the pyrimidine locus, after linearization with PvuII. The pyrimidine-targeting sites can be replaced with your targets of interest either by PCR amplification of the floxed cassette with long primers terminating in the construct sequences GATAAGCTTATAACTTCGTATAGCATACA (29 nt, the last 7 of which are from the 8-bp center of the lox sequence that is not palindromic) and GACCCACTTAGGATCCATAACTTCGTA (27nt, the last 11 of which are identical to 11 nt in the forward primer, but not complementary), or by cloning in longer targeting fragments to replace the PYR upstream and downstream targets.

The efficiency of 'PCR targeting' can vary depending on the locus, as anecdotal and more precise experience (Oberholzer M, Morand S, Kunz S & Seebeck T. (2006) Mol Biochem Parasitol 145:117-20 DOI PMID) has evidenced. With the floxed cassettes, we (Cross lab: Hee-Sook Kim) have found that PCR-targeting the second allele can be especially inefficient, probably because of the TK homology within the floxed cassettes containing different positive selectable markers. This 'second allele problem' can be obviated in two ways: either treat with cre to eliminate the first floxed cassette prior to targeting the second allele, which can now be done with the same cassette, or (if the PCR oligonucleotides are still not working), the first floxed allele can be PCR-amplified using more distant flanking primers and this product, with its much longer flanking regions, can be used to target the second allele after cre treatment to eiminate the first floxed allele (or the PCR product could be cloned and the positive selectable markers switched via two of the unique flanking restriction sites, allowing both alleles to be targeted before cre-mediated excision).

In case of difficulty targeting even the first allele, the pyrimidine targets in the provided vectors can be replaced with other PCR-amplified target loci. First, clone the downstream target sequence, with BamHI and SbfI ends into a pyrFEKO vector digested with the same enzymes, then clone the upstream target sequence, with PvuII and HindIII ends into a pyrFEKO vector digested with the same enzymes. Linearize the vector with PvuII plus SbfI. For either cloned or PCR oligo targeting, proceed as follows.

Step 1 Transfect and select for drug resistance (hygromycin, puromycin, etc). You can probably avoid cloning prior to Steps 2 & 3.
Step 2 Repeat Step 1 to target the second allele.
Step 3 Transiently transfect with a pLEW100cre plasmid (see below) and selection with Gancyclovir (GCV). The amount of GCV you need for negative selection depends on the expression level. If the TK construct is in the VSG Expression Site, 5 micrograms per ml is sufficient but you may have to use at least 30 micrograms per ml of GCV at other loci. Bloodstream forms should be grown in HMI-9 without thymidine, which cause no problems. Even after eliminating endogenous pyrimidine synthesis, the cells seemed to grow fine without adding pyrimidines, although it might be advicable to add 1 mg/liter or uracil. Unlike for thymidine, trypanosomes have a very efficient transporter for uracil (Gudin S, Quashie NB, Candlish D, Al-Salabi MI, Jarvis SM, Ranford-Cartwright LC & de Koning HP (2006) Trypanosoma brucei: a survey of pyrimidine transport activities. Exp Parasitol 114:118-25. PMID). The presence of extraordinarily high concnetrations of thymidine in HMI-9 seems to be an unexplainable anomaly, for several reasons.

The original pLEW100-cre plasmid was provided by John Donelson (Trypanosoma brucei: a first-generation CRE-loxP site-specific recombination system (2004) Barrett B, LaCount DJ & Donelson JE. Experimental Parasitology 106:37-44. DOI) with his permission to distribute it along with the modified derivatives made by us.

All the pLEW100 plasmids can be stably transfected, although for stable transfection we suggest using the one expected to have the least (essentially no) uninduced activity, which is pLEW100cre-EP1-6G. Although our paper showed data where this plasmid had slightly higher background than one with pLEW100cre-EPI, this was not predicted and was possibly due to clonal variation. A pLEW100cre-EP1-6G plasmid containing Luciferase gene showed no detectable activity (unpublished experiments by MDS). Any of the pLEW100 cre versions can be used for our recommended transient transfection expression of Cre. The version from which the Tet operator has been deleted is intended for transient use in Tet repressor-expressing cells, to avoid having to use tetracycline induction, which (in this case) would induce other tet-regulated insertions in the same cell line.

Plasmid information and download